jueves, 22 de marzo de 2012

De Milán a Verona (Norte de Italia)

RECORRIDO DE MILÁN A VERONA

Como primera entrada de recomendación de viaje, uno que me gustó mucho, que es cómodo y con una gran infinidad de cosas por ver, es a través del norte de Italia, principalmente en la Lombardía y terminando en Verona, la tierra de Romeo y Julieta.

El planning que propongo es el siguiente:



Mañana
Tarde
Noche
jueves
Vuelo Madrid-Bérgamo
Bérgamo
Bérgamo
viernes
Milán
Milán
Bérgamo
sábado
Brescia
Brescia
Verona
domingo
Verona
Verona
Verona
lunes
Verona
Vuelo Verona-Madrid


A continuación, detallo primero los transportes a realizar cada día entre una ciudad y otra. Ya, para dentro de la ciudad, nos remitiremos a la ciudad en si.

Jueves


Para nuestro primer día, lo interesantes es coger un vuelo temprano. Existe uno de Ryanair que sale de Madrid a las 06:00 de la mañana y llega a las 08:15 a Bérgamo. Existe también la posibilidad de llegar por la tarde. En este caso, el vuelo de Madrid sale a las 18:20 y llega a Bérgamo a las 20:35.


Para desplazarse del aeropuerto de Bérgamo (BGY) a la ciudad, lo más cómodo y relativamente rápido es a través del transporte público, en este caso con los autobuses. Existen diversas tarifas y ya dependiendo de las necesidades que tenga uno o las ganas de caminar, pues puede interesar un ticket u otro. Las opciones son:

  • Billete sencillo.- Cuesta 1,70 euros y da derecho a ir desde el aeropuerto de Bérgamo (también llamado Orio Al Serio) y la ciudad de Bérgamo. Es válido durante 90 minutos desde que se valida.
  • Ticket diario.- Cuesta 3,50 euros y da derecho al trayecto entre el aeropuerto y utilizar todos los servicios que se desee de transporte público (incluido el cunicular) durante todo un día.
  • Ticket 3 días.- Igual al anterior pero en este caso durante 3 días.

Aquí, para la ruta que yo sugiero, recomendaría el ticket diario ya que el hotel que propongo se encuentra a unos 200 mts. de la Estación de Bérgamo, pues prácticamente lo usaríamos el primer día, que es el dedicado a visitar la ciudad.

Viernes

 Para desplazarnos de Bérgamo a Milán, yo sugiero el tren. Creo que es el medio más idóneo para evitar atascos en la carretera y que en Italia, las estaciones de trenes son puntos neurálgicos para el resto de transportes que discurren por la ciudad. Siempre que se desee información sobre los horarios y reservas, se debe recurrir a www.trenitalia.it, que únicamente se encuentra en italiano e inglés.

Hay que tener en cuenta que algunas ciudades, como es el caso de Milán, tiene varias estaciones. Para seguir una uniformidad de criterios y no haber un exceso de información, los horarios que se pondrán, siempre será a la estación central o principal, a menos que no se indique lo contrario (como es en este caso) Asimismo, siempre se pondrán los precios en segunda categoría, que, al ser trayectos relativamente cortos, no compensa hacer un gran gasto entre una clase y otra. Algunos horarios que nos sugiere dicha web son (aunque siempre es recomendable asegurarnos debido a posibles actualizaciones), son:

HORARIO
TRAYECTO
PRECIO
08:02 - 08:50
Bérgamo-Milán Centrale
5,15 €
08:23 - 09:29
Bérgamo-Milán Porta Garibadi
4,45 €
08:32 - 09:12
Bérgamo-Milán Lambrate
5,15 €
08:53 – 09:59
Bérgamo-Milán Porta Garibaldi
4,45 €

Para los trayectos de vuelta, tenemos los siguientes horarios:

HORARIO
TRAYECTO
PRECIO
19:01 – 20:03
Milán Porta Garibadi-Bérgamo
4,45 €
19:10 – 19:58
Milán Centrale-Bérgamo
5,15 €
19:25 – 20:28
Milán Porta Garibaldi-Bérgamo
5,15 €
19:31 – 20:38
Milán Porta Garibaldi-Bérgamo
4,45 €


Si se desea hacer una prolongación a la ciudad de Como, que la recomiendo bastante y que a mi personalmente me gusta mucho, algunos horarios de trenes son:

HORARIO
TRAYECTO
PRECIO
13:39-14:38
Milán Porta Garibadi-Como S. Giovanni
4,45 €
14:39-15:38
Milán Porta Garibaldi-Como S. Giovanni
4,45 €
15:39-15:38
Milán Porta Garibaldi-Como S. Giovanni
4,45 €

Para la vuelta a Bérgamo y haciendo siempre escala en Milán, tenemos los siguientes horarios:

HORARIO
TRAYECTO
PRECIO
18:22-20:03
Como S. Giovanni-Bérgamo
6,25 €
19:12-20:38
Como S. Giovanni-Bérgamo
6,25 €
19:52-21:38
Como S. Giovanni-Bérgamo
6,25 €


Obsérvese como si en la estación pedimos el billete desde Como a Bérgamo, nos sale mucho más barato que los dos tramos por separado, concretamente de unos 9 euros a 6,25 €.

Sábado


Los trenes entre Bérgamo y Brescia, son los siguientes.

HORARIO
TRAYECTO
PRECIO
08:07-09:06
Bérgamo-Brescia
4,45 €
09:07-10:06
Bérgamo-Brescia
4,45 €
12:07-13:06
Bérgamo-Brescia
4,45 €

Los trenes entre Bérgamo y Verona, no he incluido la opción de viajar con el Frecciabianca (el AVE italiano) ya que solo tarda de 5 a 10 minutos menos y el billete se dispara hasta los 16 euros.

HORARIO
TRAYECTO
PRECIO
18:35-19:16
Brescia-Verona
6,15 €
18:56-19:50
Brescia-Verona
6,15 €
19:35-20:20
Brescia-Verona
6,15 €


Aquí, al igual que la opción de Milán, existe la posibilidad desde Brescia de visitar localidades situados en los lagos italianos como son Iseo y Monte Isola. De Brescia a Iseo, los horarios de trenes son:

HORARIO
TRAYECTO
PRECIO
15:07-15:30
Brescia-Iseo
3,05 €
15:58-16:28
Brescia-Iseo
3,05 €
17:07-17:30
Brescia-Iseo
3,05 €

Para ir a Verona, desde Iseo, algunos horarios son:

HORARIO
TRAYECTO
PRECIO
18:33-20:20
Iseo-Verona
7,35 €
19:31-21:20
Iseo-Verona
7,35 €
20:33-22:!6
Iseo-Verona
7,35 €

Lunes


La compañía Ryanair ofrece un vuelo directo entre el Aeropuerto de Verona (Capullo) y Madrid-Barajas. Su horario es de 15:50 a 18:10. Para trasladarnos de la ciudad al aeropuerto, existe un bus lanzadera (nº99) que parte de la Estación de trenes hasta el aeropuerto cada 20 minutos, desde las 05.40 hasta las 23.10. El precio del bus es de 4,5 euros por trayecto. Por experiencias en este aeropuerto y aunque no se facture maleta, recomiendo que se llegue al aeropuerto una hora y media antes de la salida del vuelo ya que hay pocos puestos de controles de seguridad y si se juntan varios vuelos, el control suele hacerse lento, con la posibilidad de perder el vuelo.


Booking.com

DETALLES DE LOS LUGARES A VISITAR

BÉRGAMO.

La ciudad de Bérgamo dispone de unos de los cascos históricos mejor conservados de Italia. Su nombre, proviene de Berg, que significa montaña en alemán y cuando estemos en la ciudad, nos daremos cuenta de dicho nombre. El casco histórico que comentamos anteriormente se encuentra justo en una montaña y que es divisible desde la parte baja de la ciudad.

Para desplazarnos por la ciudad con transporte público, ver las opciones que se comentó anteriormente.

Los lugares más recomendables para visitar son:

  • El casco histórico, con la Piazza Vecchia. Un emplazamiento fantástico.
  • La Iglesia de Santa María Maggiore.
  • El Museo Arqueológico, etc.

Como hotel de recomendación, se encuentra el BG Hostel, (www.bghostel.com) que se encuentra a 200 mts de la estación de trenes y con incluso un supermercado al lado mismo. Hay que tener en cuenta que el hotel permanece sin recepción desde la una a las seis de la mañana. Dentro del precio se incluye desayuno.










 MILÁN


Como lugares destacados a visitar en Milán, tendremos:

  • Castillo Sforzesco.- Se encuentra relativamente cerca de la Estación de Trenes de Milano Centrales y por tanto, un buen punto para visitar la ciudad.
  • El Duomo y la Galería Vittorio Emmanuele.- Es sin duda, el punto neurálgico de la ciudad y con una belleza impresionante los dos monumentos, sin duda, nos deleitará su vista.
  • Teatro La Scala.- Uno de los teatros más famosos del mundo por su gran diversidad y calidad de sus óperas.









COMO


Si en Milán no se “abusa” de museos, la podremos ver en una pocas horas ya que sus monumentos están muy cerca entre si y su eficiente linea de metros, hace que nos pongamos de un lugar a otro en pocos minutos.

Si se tiene tiempo, una visita que recomiendo (y que con atrevimiento, antepondría) sería a la localidad de Como, a una hora en tren desde Milán.

La ciudad se encuentra justo en la misma orilla del lago con el mismo nombre, lo cual, hace que, junto con su arquitectura, un lugar maravilloso para pasear. Podremos coger el funicular y disfrutar de unas maravillosas vistas de la ciudad y todo el lago. También recomiendo las siguientes visitas:

  • Duomo.- Se encuentra enclavada muy cerca del lago y con un entorno muy conservado.
  • Pasear por el lago.- Su paseo por el paseo marítimo es muy agradable. Incluso, se puede coger un aliscafi (bote) para visitar otras localidades del lago y así ver éste de una manera diferente.
  • Ir a Brunate.- Como comenté anteriormente, cogiendo un funicular, llegaremos a esta localidad, en la que podremos divisar hermosas vistas del lago y su entorno.













BRESCIA


Brescia es una ciudad que tal vez no aparezca en ningún itinerario pero fue una grata sorpresa descubrirla. Antes de llegar a la ciudad, durante el trayecto en tren entre Bérgamo y ella, les voy a dar una sugerencia. Sitúense en el lado izquierdo del tren y a los pocos minutos de salir de Bérgamo, y antes de llegar a la primera parada, que es el pueblo de Seriate, fíjense por la ventana como tendrán una hermosa vista de este pueblo con su río, cascada y la iglesia.

Ya, lo que es la ciudad de Brescia, tal vez la estación y los alrededores, les pueda defraudar un poco pero lógicamente, el encanto de un lugar en Italia, está en su casco viejo y verán como hay muchos lugares por visitar. Como lugares más representativos tenemos:

  • Ruinas romanas
  • La Nueva y Vieja Catedral
  • Convento de Santa Julia

Aquí, y al igual que ocurría en Milán, según lo rápido que hayamos visitado tendremos diversas alternativas.














ISEO Y MONTE ISOLA.

Iseo es una localidad situada en el Lago Maggiore y es mucho más pequeña que Como. Es un pueblo bastante interesante y pintoresco porque expresa un poco la vida más campestre, tranquila de Italia. Justo en el muelle de Iseo, podremos coger un barco y dirigirnos a Monte Isola, una isla situada dentro del Lago. La duración del trayecto es de unos 20 minutos y es tranquilo y agradable paseo alrededor del Lago. Ya, cuando llegamos a Monte Isola, podremos alquilar una bicicleta y dar la vuelta alrededor de la isla, un trayecto, que no nos llevará mucho tiempo.

FOTOS DE ISEO Y MONTE ISOLA





















VERONA


Verona es una hermosa ciudad y mucho por enseñarnos y ofrecernos. Para no perder el tiempo en buscar el hotel, podremos dejar las pertenencias en la consigna de la estación y tomar el autobús con línea nº1 para dirigirnos al casco histórico.

Si se va a visitar Verona, nunca debe hacerse en un lunes, ya que la gran mayoría de sus principales atracciones están cerradas. Asimismo, se recomienda comprar la Verona Card. Con esta tarjeta, que vale 10 euros por un día, tendremos acceso a las principales atracciones de la ciudad, incluida la Casa de Romeo y Julieta, así como todos los servicios públicos municipales de transportes gratuitos.

Los monumentos recomendables a visitar son:

  • El Anfiteatro Romano, Arena.- Es uno de los mejores conservados. Muy recomendable visitarlo durante la temporada de la Ópera.
  • La Casa de Julieta.- Son uno de esos símbolos que tienen todas las ciudades y que su visita es más imprescindible por ello que por el propio monumento en si.
  • El Castillo Viejo (Castelvecchio).- Un precioso castillo con un bonito puente sobre el río Fiume.
  • Torre Lamberti.- Es la torre más alta de Verona. Posibilidad de subirla por la escalera, con 238 escaleras o por ascensor.
  • Catedral de Verona (Duomo de Verona).- Una de las más hermosas de Italia.

Y muchísimos más lugares, añadiéndole a ello que tienen un excepcional casco histórico bien conservado.

























Algunos links de interés, son:

Trenes de Italia (http://www.trenitalia.it)
Turismo de Bérgamo (http://www.turismo.bergamo.it/)
Turismo de Milán (http://www.aboutmilan.com/)
Turismo de Iseo (http://www.lagodiseo.org/)

12 comentarios:

  1. GGGUUUUUUUAAAAAAUUUUUUUUU, genial el post, lo tendremos en cuenta en un futuro cuando vayamos a esas zonas.

    Saludos

    Marta

    ResponderEliminar
  2. ¡Que bien! ¡que gran trabajo! todo tan detallado y bien explicado y como guinda ilustrado con tus estupendas fotografías. Un trabajo sensacional. Mis felicitaciones mas sinceras, le auguro un gran porvenir a este blog.
    Un fuerte abrazo Daniel.

    Antonio

    ResponderEliminar
  3. Este comentario ha sido eliminado por el autor.

    ResponderEliminar
  4. Hola, viajero. Vamos a realizar un viaje siguiendo tus interesantes y prácticas sugerencias. Tenemos una duda: ¿Si hacemos noche en Verona es buena idea para ir a Padua un día y a Venecia otro? ¿Cuanto tiempo nos lleva el trayecto del tren?

    Muchas gracias y felicidades por tu blog.

    ResponderEliminar
    Respuestas
    1. Hola, para Padua está bien un día. Quizá para Venecia sean necesarios dos. El viaje entre Padua y Venecia es de media hora en tren. Saludos.

      Eliminar
  5. hola, como puedo viajar de milan a verona de forma economica, saludos :D

    ResponderEliminar
  6. hola. muy bueno el blog. gracias por ayudarnos. Un saludo

    ResponderEliminar
  7. Hola!
    Lo primero de todo, es el blog es fantástico! Sin duda lo seguiremos para los próximos viajes y una pregunta es que si es factible visitar Venecia en lugar de alguna de las ciudades propuestas?
    Gracias!

    ResponderEliminar
    Respuestas
    1. Hola Ana, muchas gracias por tu valoración positiva sobre mi blog. Si claro que es factible, relativamente podrías prescindir de Brescia y hasta me atrevería de Milán. En Venecia, debes dedicar de dos a tres días para verla bien. Aqui te dejo dos posts de mi blog, uno sobre Venecia en general, http://www.viajesparatorpes.com/2013/02/venecia.html y otro si vas para allá para ver los hermosos carnavales de Venecia, http://www.viajesparatorpes.com/2013/01/carnaval-en-venecia.html

      Saludos.

      Eliminar
  8. Este comentario ha sido eliminado por el autor.

    ResponderEliminar
  9. Muchas gracias por la información, esta muy pero muy bueno tu blog, estamos pronto a realizar un viaje a Italia desde Barcelona, (marzo) No tenes idea si la opción de alquiler coche es factible? somos varios de familia, o mejor hacerlo con conexión de tren? Muchísimas gracias

    ResponderEliminar
    Respuestas
    1. Muchas gracias por tu valoración positiva sobre mi blog. Bueno, si ya son varios en familia, tal vez ya sería analizarlo todo. La gasolina es cara en Italia (1,60 euros el litro), hay muchos peajes pagando y muchas partes de las ciudades son zona azul.
      Mi ultimo post es una guia para viajar por tren en Italia. Ahí te puedes hacer una idea. Saludos.
      http://www.viajesparatorpes.com/2016/07/guia-para-viajar-en-tren-por-italia.html

      Eliminar